Late Blight Resistance of RB Transgenic Potato Lines

Late blight of potato (Solanum tuberosum L.), incited by Phytophthora infestans (Mont.) de Bary, is a devastating disease affecting tuber yield and storage. Recent work has isolated a resistance gene, RB, from the wild species Solanum bulbocastanum Dun. Earlier work in Toluca, Mexico, observed significant levels of field resistance under intense disease pressure in a somatic hybrid containing RB. In this study, five transgenic RB lines were recovered from the late blight susceptible line MSE149-5Y, from the Michigan State University (MSU) potato breeding program. Transgenic lines were molecularly characterized for the RB transgene, RB transcript, and insertion number of the kanamycin resistance gene NPTII. Transgenic lines and the parent line were evaluated for resistance in field and laboratory tests. Molecular characterization alone did not predict which lines were resistant. Three of the RB transformed MSE149-5Y lines showed increased resistance under field conditions at MSU and increased resistance in detached leaf evaluations using multiple isolates individually (US-1, US-1.7, US-8, US-10, and US-14). Transfer of RB into late blight susceptible and resistant lines could provide increased protection to potato late blight. The use of the RB gene for transformation in this way creates a partially cisgenic event in potato because the gene’s native promoter and terminator are used. This type of transformation provides a chance to generate greater public acceptance of engineered approaches to trait introgression in food crops. Late blight of potato incited by Phytophthora infestans is responsible for significant annual losses in North America (Guenthner et al., 1999) and worldwide (Hijmans, 2003). The effect of climate change on potato production (Hijmans, 2003) and potato late blight (Baker et al., 2005) may result in reduced yield and increased risk of development of epidemics of potato late blight. Frequent fungicide spray intervals and rates currently used by growers to control late blight are expensive. Host resistance is an alternative control measure that is more economically and environmentally sustainable. In the early 1900s, potato breeders successfully introgressed resistance from the Mexican wild species Solanum demissum Lindl. into cultivated potato (Muller and Black, 1952). However, major gene resistance from S. demissum was quickly overcome by P. infestans (Wastie, 1991). A total of 11 major dominant resistance genes (R genes) were identified from S. demissum (Malcolmson, 1969; Malcolmson and Black, 1966; Muller and Black, 1952). Most S. demissum R genes have been located to potato chromosomes and R1 and R3a have already been sequenced (Ballvora et al., 2002; Bradshaw et al., 2006; Huang et al., 2005). Although these genes have been defeated by P. infestans, there is some evidence that they may be useful when combined with other sources of resistance (Stewart et al., 2003). As races of P. infestans overcame resistance from S. demissum researchers have turned to other Solanum L. species for resistance genes. A multitude of genes have been mapped, and several have been cloned and sequenced. The resistance gene RPi-ber, from Solanum berthaultii Hawkes, was mapped to chromosome X (Ewing et al., 2000; Rauscher et al., 2006). Rpimoc1, identified in Solanum mochiquense Ochoa, mapped to chromosome IX (Smilde et al., 2005). Rpi-phu1 was identified from Solanum phureja Juz. et Buk. and mapped to chromosome IX (Śliwka et al., 2006). Rpi1 from Solanum pinnatisectum Dun. was mapped to chromosome VII (Kuhl et al., 2001). A major QTL from Solanum microdontum Bitt. (Bisognin et al., 2005) was recently mapped to chromosome IV (D.S. Douches, unpublished data). Solanum bulbocastanum has yielded several resistance genes. Two alleles from a single locus on chromosome VIII were identified and cloned, RB (Song et al., 2003) and Rpi-blb1 (van der Vossen et al., 2003). Rpi-blb2 was localized to chromosome VI and subsequently cloned (van der Vossen et al., 2005). Another gene, Rpi-blb3, has been mapped to chromosome IV (Park et al., 2005). The increasing pool of genes conveying resistance to late blight of potato raises the question of how to incorporate such resistance into cultivated lines. The cultivated potato, S. tuberosum, is tetraploid (4x) with an endosperm balance number (EBN) of 4, resulting in crossing barriers with wild Solanum species that differ in ploidy or EBN (Hanneman, 1999). Although classical methodologies have been used to overcome such barriers (Hermsen and Ramanna, 1973), the desire to incorporate more than one source of resistance presents increased challenges for the potato breeder. Plant transformation offers an efficient method to transfer genes from divergent organisms directly into the plant genome (Sharma et al., 2005). Transformation also allows both the quantity, through gene pyramiding, and timing of resistance genes to be controlled on a relatively short time scale. Resistance genes are potentially useful control measures for potato late blight. Both RB and Rpi-blb1 have broad-spectrum resistance and conferred resistance to a range of isolates of P. Received for publication 15 Dec. 2006. Accepted for publication 5 July 2007. Current address: United States Department of Agriculture, Agricultural Research Service, Subarctic Agricultural Research Unit, Palmer, AK 996456629. Department of Plant Pathology, Michigan State University, East Lansing, MI 48824. Corresponding author. E-mail: [email protected]. J. AMER. SOC. HORT. SCI. 132(6):783–789. 2007. 783 infestans carrying multiple virulence factors (Song et al., 2003; van der Vossen et al., 2003). RB has also been shown to maintain resistance in Toluca, Mexico under intense disease pressure (Helgeson et al., 1998). However, successful insertion of a transgene into the genome does not guarantee a positive phenotype. van der Vossen et al. (2003) reported that 15 of 18 Rpi-blb1 transformed potato lines were resistant and seven of nine tomato (Solanum lycopersicum L.) transformants showed resistance. Song et al. (2003) reported that of 14 RB transformed lines, 5 were highly resistant and 9 were moderately resistant, having <10% and 11% to 25% infection, respectively, in comparison with non-transformed lines. Successful transformation requires confirmation that the gene or genes are not only intact and transcribed/translated but that the desired phenotype is also recovered. The objectives of this study were to evaluate the recovery of effectively transformed progeny plants of the potato advanced breeding line MSE149-5Y and to determine the resistance of these transformed lines to different genotypes of P. infestans in detached leaf tests and the field. Materials and Methods GENERATION OF TRANSGENIC LINES. Michigan State University breeding line MSE149-5Y was used for all transformations reported here. MSE149-5Y is not known to have any major late blight R gene. Plasmid 2.4.48pCRXLTOPO (J. Jiang, personal communication) was digested with BamHI, and the 8.59-kb fragment containing RB was isolated, including 2.5 kb upstream of the start ATG and 2.48 kb downstream of the stop codon. This fragment was ligated to pBINPLUSARS (U.S. Department of Agriculture, Albany, CA) (Garbarino and Belknap, 1994), which had been digested with BamHI, and the new construct called pSPUD69 (Fig. 1). Agrobacterium tumefaciens (Smith & Towns.) Conn.-mediated transformations using a kanamycin marker were conducted according to Douches et al. (1998). The explants were prepared for transformation by cutting internodes of the stem from tissue culture plantlets. When callus nodules produced shoots 5–7 mm in length, the shoots were excised and placed in rooting medium (modified MS medium with the addition of kanamycin at 50 mg L to identify successful transformants) in 25 · 150-mm culture tubes. A single shoot was removed from each callus to ensure selection from independent transformation events. Rooted transformants expressing resistance to kanamycin were maintained by micropropagation. Rooted putative transgenic plants in the MSE149-5Y background were denoted as E69 followed by the shoot number. MOLECULAR CHARACTERIZATION. DNA extractions were conducted using a 2· CTAB procedure (Doyle and Doyle, 1987). Detection of transgene insertions used 30 ng of total genomic DNA at a final concentration of 1.5 mg L. REDTaq DNA Polymerase (Sigma-Aldrich Co., St. Louis) was used following the manufacturer’s directions. RB primers specific for the resistant allele (Colton et al., 2006) amplified a 213-bp fragment (forward, 5# CACGAGTGCCCTTTTCTGAC 3# and reverse, 5# ACAATTGAATTTTTAGACTT 3$). NPTII primers amplified a 267-bp fragment (forward 5# CGCA GGTTCTCCGGCCGCTTGGGTGG 3# and reverse, 5# AGCA GCCAGTCCCTTCCCGCTTCA 3#). RB and NPTII primers were annealed at 43 and 60 C, respectively. A PerkinElmer 9600 thermal cycler (Wellesley, MA) was programmed for a hot start (95 C, 5 min) and 35 cycles of 95 C, 30 s denaturing, 43 C or 60 C, 30 s annealing, and 72 C, and 30 s extension, with a final extension of 72 C, 5 min. Fragments were separated on 1.0% agarose gel. RNA extractions were conducted using the RNeasy Plant Mini Kit (QIAGEN, Valencia, CA). One microgram of RNA was treated with deoxyribonuclease I (Invitrogen Corp., Carlsbad, CA) and inactivated according to the manufacturer’s guidelines. cDNA was generated from total RNA using MMLV Reverse Transcriptase (Invitrogen Corp.) according to the manufacturer’s guidelines. Polymerase chain reaction (PCR) was conducted with REDTaq DNA Polymerase (Sigma-Aldrich Co.) according to the manufacturer’s guidelines. RB and NPTII primers were the same as above. Positive control was EF1a (forward, 5# GGTGGTTTTGAAGCTGG TATCTCC 3# and reverse, 5# CCAGTAGGGCCAAAGGTCA CA 3#), 50 C annealing temperature. Fragments were separated on 1.0% agarose gel. SOUTHERN HYBRIDIZATIONS. Twenty micrograms of endorestriction-digested (BamHI, EcoRI, and HindIII) DNA per sample was transferred to Amersham Hybond-N membrane (GE Healthcare, Piscataway, NJ) using a standard alkaline lysis procedure (Kennard et al., 1994). Isolated fragments of RB and NPTII were labeled with [a-P]dCTP with the Random Primers DNA Labeling system (Invitrogen Corp.), and un-incorporated nucleotides were removed with Bio-Spin 30 Tris columns (Bio-Rad, Hercules, CA). Hybridizations were conducted as described in Kuhl et al. (2001). Hybridization with RB used a 1562-bp fragment, bp 1794 through bp 3356 from ATG, including the 213-bp region used to distinguish resistant and susceptible alleles. Highly stringent final wash conditions were used 0.1· SSC and 0.1% SDS for a total of 52 min at 60 C. Hybridization with NPTII used a 700-bp fragment. The final wash condition included 2· SSC, 0.1% SDS for 30 min at 50 C followed by 0.1· SSC, 0.1% SDS for 20 min at 60 C. DETACHED LEAF TESTS. Isolates of different genotypes of P. infestans used in detached leaf tests are described in Table 1. Isolates were transferred through healthy, detached leaflets of a susceptible cultivar (Red Craig’s Royal, not known to contain any R-genes) within 1 year of the conducted tests. Sporangial/ zoospore suspensions were derived from each isolate using three to five 13-d-old cultures grown on rye A agar (Caten and Jinks, 1968). Sporangia were released from the surface of the plate by immersion in sterile distilled water (SDW), followed by scraping with a sterile glass rod. Zoospore release was stimulated by incubation for 2 h at 4 C, followed by warming at 18 C for 30 min. Suspensions were subsequently examined using a binocular microscope to confirm the release of zoospores, calibrated by counting with a hemocytometer and Fig. 1. T-DNA region of pSPUD69. RGA2-PCR indicates the 8.59-kb BamHI fragment containing the RB gene ligated into the pBINPLUSARS base plasmid. This construct includes the NPTII gene for kanamycin resistance controlled by the ubiquitin (Ubi3) promoter (Pro) and terminator (Term). Natural promoter (2503-bp upstream) and termination sequences (2477-bp downstream) were used for RB. The region in the T-DNA where the RB primers anneal is designated by ‘‘PCR Product.’’ 784 J. AMER. SOC. HORT. SCI. 132(6):783–789. 2007. adjusted to about 2.0 · 10 sporangia/mL using SDW (Kuhl et al., 2001). Inoculations were conducted essentially according to Kuhl et al. (2001) on 12 Dec. 2004 and replicated 3 Jan. 2005. Five plants per line of greenhouse-grown plants were used. Five fully developed leaves were selected from the upper portion of each plant and one leaf randomly assigned per P. infestans isolate, so that five leaves total were used per isolate. Three layers of absorbent paper towels were placed in the bottom of 150-mm-diameter petri dishes with a layer of plastic mesh on top, and 38 mL of SDW was added to the towels in each plate. Detached leaves were placed abaxial side up on the plastic mesh and then sprayed using a hand-held sprayer, once with SDW and once with P. infestans inoculum (0.7-mL spray volume per plate per spray). Petri dishes were wrapped with parafilm and placed into dark incubators at 17 C with 12-h light cycle. For all experiments incubator shelves and positions were randomized. Pi95-3 (US-1) and Pi99-2 (US-14) did not produce sufficient sporangia although 1.0 · 10 sporangia/mL were used at both inoculations for Pi95-3 and 2.0 · 10 and 1.4 · 10 sporangia/mL were used for Pi99-2 at inoculations 1 and 2, respectively. Leaves were scored at 6, 9, and 12 d after inoculation (DAI) using disease severity indices (DSI) based on percentage of leaf area affected: 0 = no symptoms, 1 = 0% to 5%, 3 = 6% to 25%, 5 = 26% to 50%, 7 = 51% to 75%, 9 = 76% to 100% (Kuhl et al., 2001). Scores were converted to mean percentage values by using the midpoint value in each interval (Haynes et al., 1998). Percentages were used to calculate area under the disease progress curve (AUDPC) according to Shaner and Finney (1977) and analysis of variance conducted using XLSTAT (version 2006.5; Addinsoft, New York, NY). FIELD EVALUATIONS. Inoculated fields trials were conducted in 2004 and 2005 at the Michigan Agricultural Experimental Station Muck Soils Research Farm, Laingsburg, MI. Plots were irrigated as necessary to maintain canopy and soil moisture conditions conducive for development of foliar late blight (Kirk et al., 2005) with turbine rotary garden sprinklers (Gilmour Group, Somerset, PA) at 1.05 L ha of water per hour and managed under standard potato agronomic practices. In 2004, five tissue-culture-derived plants per plot were transplanted to the field and each line replicated twice. Inoculation in 2004 used a mixture of isolates later used in detached leaf test and listed in Table 1, except for SR83-84 (US-10). In 2005, 10 tissue-culture-derived plants per plot were transplanted to the field and replicated 3 times. The most promising resistance lines were retested in 2005, thereby dropping E69.03 and E69.04. All the isolates listed in Table 1 and isolates Pi96-2 (US-1.7), Pi95-7, Pi02-003, Pi02-006 (US8), Pi96-1 (US-11), and Pi94-2, Pi98-1, and Pi00-001 (US-14) were used to inoculate the field plots in 2005. Sporangia were counted with a hemacytometer and the concentration was adjusted to 2.0 · 10 sporangia/mL using SDW. The sporangial solution was chilled to 4 C for 8 h to promote release of zoosporangia from the sporangia. All plots were inoculated simultaneously in both years using an overhead sprinkler irrigation system. The zoospore suspension of mixed isolates of P. infestans was injected into the irrigation water feed pipeline under 0.5 kg cm of CO2 pressure and applied at a rate of 150 mL m of inoculum solution of trial area to give an inoculation rate of about 2.4 · 10 zoosporangia/m (2.4 · 10 zoospores ha). This amount and rate of inoculum applied were estimated from prior calibration of the irrigation system and were intended to expose all potato foliage to inoculum of P. infestans. As soon as late blight symptoms were detected (about 7 DAI), each plant within each plot was visually rated at 3to 5d intervals for percent leaf and stem (foliar) area with late blight lesions. The mean percent blighted foliar area per treatment was calculated. Evaluations continued until plots of susceptible cultivars reached 100% foliar area diseased. DAI to the time until 100% foliar area in susceptible cultivars diseased was reached was used as a key reference point for calculation of relative area under the disease progress curve [RAUDPC (Kirk et al., 2001)]. Analysis of variance was calculated using JMP (version 5.0.1; SAS Institute Inc., Cary, NC).